PCR base cloning -Primer Selection

Last update April 5, 2008

Here in is an example of PCR based cloning of gene STX4 to to pET 20 plasmid vector. pET 20 vector is an C-terminal 6xHis-tag protein expression vector, which is available from "Novagene". If you want to know more about this protein expression system read here.

• The first step is to find the cDNA sequence of gene STX4 from the Gene Bank. Remove non coding 5 and 3 UTR (UnTransleted Regions) from the DNA . Don't forget to remove the stop codon of the gene since it will be fussed to the His tag. Paste the the DNA sequence into the form below. Format the gene.

DNA SEQUENCE

(copy/paste your sequence here)

Nucleotides per row (bp) Nucleotide group of
TAACATATGCGCGACAGGACCCATGAGTTGAGGCAGGGGGATAACATCTCAGACGATGAAGATGAGGTTCGAGTCGCGTTGGTGGTGCACTCAGGTGCCGCCCGGCTGAGCAGCCCGGACGACGAGTTCTTCCAGAAGGTGCAGACAATTCGGCAGACTATGGCCAAACTGGAGAGTAAAGTCCGGGAGTTGGAGAAACAGCAGGTCACCATTCTGGCCACGCCTCTTCCCGAGGAGAGCATGAAGCAGGGCCTGCAGAACCTGCGAGAGGAGATCAAACAGCTGGGGAGAGAAGTCCGGGCACAGCTAAAAGCCATAGAGCCCCAGAAGGAAGAAGCTGATGAGAATTATAATTCAGTCAACACAAGAATGAAGAAAACCCAGCATGGGGTCCTGTCCCAGCAGTTTGTGGAGCTCATCAACAAGTCAAATTCAATGCAGTCCGAGTACCGAGAGAAGAACGTGGAGCGCATTCGGCGGCAGCTGAAGATCACCAATGCTGGAATGGTGTCTGACGAGGAACTGGAGCAGATGCTGGACAGTGGGCAGAGTGAGGTGTTTGTGTCTAATATACTGAAGGACACACAGGTGACCCGGCAGGCCCTGAATGAGATCTCTGCGCGACACAGTGAGATCCAGCAGTTGGAGCGCAGCATCCGTGAACTCCATGAGATCTTCACTTTTCTAGCTACCGAGGTGGAGATGCAGGGAGAGATGATCAATCGTATCGAAAAGAACATTCTGAGCTCAGCAGACTATGTGGAACGTGGGCAAGAACATGTCAAGATAGCGCTAGAGAATCAGAAGAAGGCGAGGAAGAAAAAGGTCATGAAGCTTTAA

 

• Second step is to decide the Restriction Enzymes we are going to use . To do this we have to consider 3 terminal end of the gene is in a frame with the fussed part in this case His tag. The same is true for the Forward primer, but in this case we don't need to consider frame shift as far as we remove all possible start codons after TATA box. Obviously Nde I restriction site just does this and is the best choice for the forward primer (see the Example Fig). HindIII site is a good for the reverse primer. (When you chouse Restriction sites considerations are 1. Good restriction enzymes with no star activity. 2. Compatibilities, both enzymes can be used with the same restriction buffer, avoiding sequential digestion. 3. Distance. Cloning site adds unnecessary amino acids to the fusion protein. Distant Restriction sites improves cutting efficiency of the vector)
• Type the Restriction Site sequence on your sequence; Nde1 on 5 end (NdeI sequence is CATATG and if you typed directly to your gene you will have two ATG codons, so consider Removing one ATG) and HindIII on 3 end (sequence of HindIII is AAGCTT). Now, if you split your sequence into codons and you will see there are complete set (On the top form change the option Nucleotide group to 3). See HindIII restriction site on the vector pET20 cloning site ( Example Fig). Now, you can split the the DNA after Hind III into codons. If it is not in frame you have to add extra one or two nucleotides between your gene and the restriction site to insure a right frame with the fusion tag.
• Additional three nucleotides are necessary if you are attempting direct digestion of the PCR product. It facilitates the enzyme digestion. (TAA) on both sites is usually my choice, although could be anything.(Consider: T-A bonds are less energetic then G-C, so you can adjust primer annealing temperature by changing T-A to G-C).
• Select about 30 bp region of the gene on its 5' terminal for the Forward primer and 30 bp of 3' end of the gene, which will be our Reverse prime. (Consider the 3' end of the primer must end on C or G, although this is not a general rule it adds to the good annealing of the primer especially at its 3' end.) Paste the Reverse primer into the form below to change to complimentary and direction to (5------>3)

• After this step primers are ready for submission. Before that it is a good practice to check the Melting Temperature of the primers.The Melting temperature of the both primers must be around the same value. You may extend the primers to adjust the Melting Temperature if the difference is more then 15° C. Click here to check the annealing temperature of your primers.

Example Primer Selection

There are a number of different ways to calculate the melting temperature of an oligonucleotide. All of these methods will give different results. Please keep in mind that all of these calculations are theoretical! Exact melting temperatures must be determined empirically. For oligonucleotides <= 20 bases, use the classical Tm = 2(A + T) + 4(G + C) calculation for melting temperature, according to Wallace rule for short oligonuceotides (1). For oligonucleotide > 20 bases, calculation is based on the Nearest-Neighbor formula with [salt] = 50 mM and single strand concentration = 250 pM (2). You can find more comprehensive calculation of oligos melting temperature at Useful Conversion Part 1 see bellow.

(1) Wallace, R.B.; Shaffer, J.; Murphy R.F.; Bonner, J.; Hirose, T.; Itakura, K.; (1979) Nucelic Acid Res. 6, 3543
(2) Breslauer, K.J.; Frank, R.; Blöcker, H.; Marky, L.A.; (1986) Proc.Natl.Acad.Sci.USA 83, 3746-3750